Covid-19 - Wodór molekularny

Wodór hamuje proliferację i migrację komórek raka żołądka poprzez modulację osi lncRNA MALAT1/miR-124-3p/EZH2

Badanie to wykazało skuteczność wodoru molekularnego w hamowaniu wzrostu raka żołądka poprzez zmniejszenie proliferacji i migracji komórek raka żołądka, co nastąpiło poprzez obniżenie poziomu lncRNA MALAT1 i członka rodziny grupy Polycomb EZH2 oraz zwiększenie poziomu miR-124-3p. Co więcej, miR-124-3p hamował ekspresję EZH2 i wzajemnie tłumił ekspresję siebie nawzajem za pomocą lncRNA MALAT1. Dane te wskazują, że H2 powinien być dalej badany pod kątem leczenia raka żołądka, a oś lncRNA MALAT1/miR-124-3p/EZH2 byłaby nowym celem interwencji.

Baocheng Zhu ,  Hengguan Cui i  Weiqiang Xu

https://cancerci.biomedcentral.com/articles/10.1186/s12935-020-01743-5 – tłumaczenie Google

Tło

Rak żołądka jest jednym z najpowszechniejszych i najbardziej śmiertelnych nowotworów złośliwych, dla którego nie ma skutecznej metody leczenia. Celem tego badania było zbadanie wpływu gazowego wodoru na zachowanie komórek raka żołądka.

Metody

Linie komórkowe raka żołądka MGC-803 i BGC-823 traktowano mieszaniną gazową H2/O2 lub bez niej ( 66,7 % :33,3% obj./obj.). Proliferację i migrację oceniano odpowiednio za pomocą testu MTT i testu gojenia ran poprzez zadrapanie. Ekspresję lncRNA MALAT1, miR-124-3p i EZH2 analizowano za pomocą ilościowej PCR w czasie rzeczywistym i/lub Western blot. Wzrost guza oszacowano przy użyciu mysiego modelu heteroprzeszczepu.

Wyniki

Gaz H2 znacząco hamował wzrost nowotworu żołądka in vivo oraz proliferację, migrację i ekspresję lncRNA MALAT1 i EZH2 komórek raka żołądka, jednocześnie zwiększając ekspresję miR-124-3p Nadekspresja LncRNA MALAT1 zniosła wszystkie wyżej wymienione efekty H2 . LncRNA MALAT1 i miR-124-3p wzajemnie hamowały wzajemną ekspresję. MiR-124-3p naśladuje zniesiony lncRNA MALAT1 promujący ekspresję EZH2 oraz proliferację i migrację komórek raka żołądka.

Wnioski

Dane te wykazały, że H2 można opracować jako lek na raka żołądka, a oś lncRNA MALAT1/miR-124-3p/EZH2 może być celem interwencji.

Tło

Rak żołądka jest szóstym najczęściej występującym nowotworem z ponad milionem nowych przypadków na całym świecie w 2018 r. i powoduje drugą co do śmiertelności wśród nowotworów złośliwych [ 1 ]. Chociaż infekcja Helicobacter pylori jest najczęstszą przyczyną raka żołądka, wiele czynników żywieniowych i stylu życia, takich jak picie, palenie, aktywność fizyczna, nadwaga, spożycie owoców i warzyw, jest również istotnie powiązanych z rozwojem raka żołądka [ 2 ] . Genetycznie głównym onkogenem raka żołądka jest CDH1 (E-kadheryna), ponieważ wiele wariantów patogennych jest powiązanych z rodzinnym rakiem żołądka o charakterze rozlanym [ 3 , 4 ]. Jednakże wiele innych genów, w tym MSH2 , PMS2 ,,Stwierdzono, że BRCA1, PALB2, CTNNA1 i ATM zwiększają ryzyko raka żołądka [ 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 ].

Długie niekodujące RNA (lncRNA) to transkrypty większe niż 200 par zasad i podobne do mRNA pod względem biochemicznym i strukturalnym, ale nie kodują białek [ 13 ]. Wiele lncRNA powiązano z różnymi aspektami biologii raka [ 14 ]. Wykazano, że LncRNA MALAT1 (transkrypt 1 gruczolakoraka płuc związany z przerzutami) promuje proliferację i migrację komórek nowotworowych, przejście nabłonkowo-mezenchymalne i przerzuty wielu typów nowotworów, ale ostatnio odkryto, że działa jako supresor nowotworu w przypadku raka piersi i jelita grubego [ 16 ] LncRNA MALAT1 zwiększał łodygę, proliferację, migrację, inwazję i lekooporność komórek raka żołądka [ 17 , 18 , 19 ,20 ].

Chociaż stwierdzono, że wodór gazowy jest skuteczny w leczeniu raka płaskonabłonkowego myszy i uważa się, że można go zastosować w leczeniu innych nowotworów [ 21 ], jego zastosowanie kliniczne nie było szeroko badane aż do 2007 roku Ohsawa i in. wykazali, że gazowy wodór selektywnie eliminował rodnik hydroksylowy, a osłabienie ogniskowego niedokrwienia i reperfuzji powodowało stres oksydacyjny i uszkodzenie mózgu [ 22 ]. Coraz więcej dowodów wskazuje na potencjał gazowego wodoru w zapobieganiu różnym nowotworom i łagodzeniu ich [ 23 ]. Picie wody bogatej w wodór przez 6 tygodni zmniejszyło ilość reaktywnych metabolitów tlenu we krwi, utrzymało potencjał oksydacyjny krwi, poprawiło jakość życia chorych na złośliwego raka wątroby po radioterapii [ 24] Codzienna inhalacja wodoru przez 3 miesiące spowodowała zmniejszenie przerzutowego raka pęcherzyka żółciowego i poprawę jakości życia [ 25 ]. Celem tego badania jest zbadanie wpływu gazowego wodoru na komórki raka żołądka i leżącego u jego podstaw mechanizmu molekularnego.

Materiały i metody

Hodowlę komórkową

Linie komórkowe ludzkiego raka żołądka MGC-803 i BGC-823 zakupiono z kolekcji kultur typu Chińskiej Akademii Nauk (Szanghaj, Chiny). Komórki hodowano w temperaturze 37°C i 5% CO2 w zmodyfikowanej pożywce Eagle firmy Dulbecco (DMEM) uzupełnionej 10% płodową surowicą bydlęcą (FBS), 100 U/ml penicyliny i 100 µg/ml streptomycyny (wszystkie z ThermoFisher, ( Szanghai Chiny).

Mieszaninę gazowego wodoru/tlenu (66,7%:33,3% obj./obj.) wytworzono za pomocą generatora wodoru/tlenu (Asklepius Meditec, Szanghaj, Chiny). Obróbkę wodorem przeprowadzono w regulowanym inkubatorze do hodowli komórek z trzema gazami (Puhe Bio, Wuxi, Chiny). Wektor nadekspresyjny MALAT1 (GenScript, Nanjing, Chiny) i mimetyki miR-124-3p (GeneCopoeia, Guangzhou, Chiny) transfekowano przy użyciu Lipofectamine 3000 (ThermoFisher, Szanghaj, Chiny).

Test MTT

Posiano 5000 komórek MGC-803 lub BGC-823 na studzienkę w 96-studzienkowych płytkach i hodowano w temperaturze 37°C przez noc, a następnie poddano działaniu wodoru lub bez niego przez 24 godziny. Do każdej studzienki dodano 20 µl 5 mg/ml MTT (bromek 3-(4,5-dimetylotiazol-2-ilo)-2,5-difenylotetrazoliowy) i inkubowano w temperaturze 37°C przez 4 godziny. Pożywkę ostrożnie usunięto i do każdej studzienki dodano 100 µl rozpuszczalnika MTT (4 mM HCl i 0,1% Nondet P-40 (NP40) w izopropanolu). Płytki inkubowano w temperaturze pokojowej z wytrząsaniem orbitalnym przez 15 minut przed odczytem przy 590 nm.

Czy gojenie będzie testem zadrapań

Gdy komórki MGC-803 i BGC-823 na 24-studzienkowych płytkach osiągnęły konfluencję, komórki traktowano 0,2 mg/ml mitomycyny C przez 3 minuty. Środek studzienek zarysowano niebieską końcówką i sfotografowano. Następnie płytki hodowano w temperaturze 37°C przez 12 godzin i fotografowano. Luki mierzono za pomocą ImageJ (NIH, Bethesda, MD). Szybkość migracji obliczono jako (odległość przerwy w 0 godz. – odległość przerwy w 24 godz.)/odległość przerwy w 0 godz. *100.

Ilościowa reakcja łańcuchowa polimerazy w czasie rzeczywistym (RT-qPCR)

Całkowity RNA ekstrahowano przy użyciu zestawu do ekstrakcji MiniBEST Universal RNA Extraction Kit (TaKaRa, Pekin, Chiny) zgodnie z instrukcją producenta. Pierwszą nić cDNA zsyntetyzowano z 0,5 µg całkowitego RNA przy użyciu zestawu Invitrogen SuperScript III Reverse Transcriptase (ThermoFisher, Szanghaj, Chiny). Niekodujące małe RNA były najpierw poli(A) z ogonem E. coliPolimeraza poli(A) (M0276, NEB, Ipswich, MA), a następnie poddana odwrotnej transkrypcji przy użyciu odwrotnej transkryptazy wirusa białaczki myszy Moloneya (M-MuLV, MMLV) (M0253, NEB) z GTCGCAGTGCAGGGTCCGAGGTGCGATTTTTTTTTTTTTTTTTTTTTT(A/G/C)(A/G /T/C) jako podkład. Amplifikację RT-PCR w czasie rzeczywistym przeprowadzono na ABI StepOne Plus (Applied Biosystems, Foster City, Kalifornia) przy użyciu zestawu SYBR Premix Ex TaqTM (Takara, Pekin, Chiny). Starterami do PCR były TGCTGTGTGCCAATGTTTCG i CAGCTGCCTGCTGTTTTCTG dla MALAT1, CTGCTTCCTACATCGTAAGTGCAA i TTGCTCCCTCCAAATGCTGGT dla wzmacniacza podjednostki 2 represyjnego kompleksu zeste 2 Polycomb (EZH2), CTGAGGAGCAGCTTCAGTCC i GAGTAGCCATTGTCCACGCT dla β-kateniny ( CTNNB1) oraz CCGAGAATGGGAAGCTTGTC i AAGCACCAACGAGAGGAGAA dla dehydrogenazy aldehydu glicerynowo-3-fosforanowego (GAPDH ). TAAGGCACGCGGTGAATGC dla miR-124-3p i CGCAAGGATGACACGCAAATTC dla U6 z uniwersalnym podkładem zwrotnym GTGCAGGGTCCGAGGT. Względną ekspresję genów obliczono za pomocą 2 Metoda ΔΔCt z GAPDH jako kontrolą wewnętrzną dla lncRNA MALAT1 i EZH2 oraz U6 dla miR-124-3p.

Podobne Treści :  H2 Wodór gaz terapeutyczny - zmiana pojmowania WODORU Z GAZU OBOJĘTNEGO DO GAZU TERAPEUTYCZNEGO

Western blot

Komórki MGC-803 i BGC-823 poddano lizie buforem do lizy RIPA (1% v/v NP-40, 20 mM Tris-HCL pH 7,4, 5 mM pirofosforan sodu, 5 mM EDTA) uzupełnionym koktajlem inhibitorów proteazy i fosfatazy (Millipore Sigma, Burlington, MA). Próbki całkowitego białka (40 µg) rozdzielono na 8% żelach SDS-PAGE i przeniesiono na membrany PVDF. Błony blokowano w 5% odtłuszczonym mleku w TBST (50 mM Tris, pH 7,5; 150 mM NaCl; 0,1% Tween 20) przez 30 minut, inkubowano z przeciwciałami pierwszorzędowymi w temperaturze 4°C przez noc, przemywano i inkubowano z odpowiednią peroksydazą chrzanową skoniugowaną koza przeciwko mysim lub króliczym przeciwciałom IgG (Jackson ImmunoResearch, West Grove, PA) w temperaturze pokojowej przez 60 minut przed wizualizacją za pomocą odczynników o zwiększonej chemiluminescencji (ECL) (Pierce, Rockford, IL). Stosowanymi przeciwciałami pierwszorzędowymi były anty-EZH2 (05-1319,

Modele ksenoprzeszczepu żołądka u myszy

Protokół dotyczący zwierząt został zatwierdzony przez Instytucjonalną Komisję ds. Opieki i Wykorzystania Zwierząt Szpitala Zhongshan stowarzyszonego z Uniwersytetem Fudan (ZHFU20200374). Samice myszy BALB/c nude (w wieku 5 tygodni) zakupiono od Cavens Laboratory Animal Inc (Changzhou, Chiny) i aklimatyzowano przez tydzień. Komórki BGC-823 (1 x 106 ) stabilnie transfekowane lncRNA MALAT1 lub miR-124-3p wstrzyknięto podskórnie w bok nagiej myszy (n = 7). Trzy dni później myszy poddawano działaniu mieszaniny wodoru i tlenu (2:1 obj.:obj.) przez 2 godziny dziennie. Wszystkie myszy uśmiercono 5 tygodni po zaszczepieniu.

Analizy statystyczne

Wszystkie doświadczenia przeprowadzono 3 razy w trzech powtórzeniach. Analizy statystyczne przeprowadzono przy użyciu GraphPad Prism 6 (San Diego, Kalifornia). Różnice między sposobami leczenia oceniano za pomocą analizy wariancji, a następnie testów Bonferroniego. Wartość p mniejszą niż 0,05 uznawano za istotną statystycznie.

Wyniki

Wodór hamował proliferację i migrację komórek raka żołądka

Ponieważ wykazano, że wodór hamuje postęp raka [ 25 ] i proliferację komórek raka płuc [ 26 ], najpierw sprawdziliśmy, czy może on mieć wpływ na proliferację komórek raka żołądka. Po 24-godzinnej ekspozycji na gazowy wodór liczba żywych komórek MGC-803 i BGC-823 zmniejszyła się o ponad 20% w porównaniu z normalnie hodowanymi komórkami (ryc.  1 a). Ponadto gaz H2 drastycznie zmniejszył ruchliwość komórek MGC-803 o około 60% i komórek BGC-823 o ponad 50% (ryc.  1 b, c).

Ryc. 1
rysunek 1

Gazowy H2 hamował proliferację i migrację komórek raka żołądka . komórki  MGC-803 i BGC-823 hodowano z lub bez H2 przez 24 godziny i oceniano za pomocą testu MTT. b  Migrację komórek MGC-803 i BGC-823 oznaczono za pomocą testu gojenia się ran poprzez zadrapanie. c  Analiza ilościowa danych migracyjnych. Pasek skali: 25 µm. Ctrl, Normalne warunki hodowli. *p < 0,01 w porównaniu do Ctrl

Gazowy wodór hamował ekspresję MALAT1 i EZH2

Analiza mikromacierzy wykazała, że ​​gazowy H2 znacząco hamował ekspresję lncRNA MALAT1 i czynnika transkrypcyjnego EZH2 w komórkach MGC-823 (ryc.  2a ). Ilościowa PCR w czasie rzeczywistym potwierdziła, że ​​24-godzinna ekspozycja na H2 obniżyła poziomy transkryptów RNA MALAT1 i EZH2 o około 50% zarówno w komórkach MGC-803, jak i BGC-823 (ryc.  2 b). Poziomy białka EZH2 w komórkach MGC-803 i BGC-823 traktowanych H2 spadły o ponad 50% w porównaniu z komórkami kontrolnymi (Fig.  2c ).

Ryc. 2
Rysunek 2

Ekspresja lncRNA MALAT1 i jego genów docelowych w komórkach raka żołądka była hamowana przez H2 . Mapa  cieplna genów o różnej ekspresji w komórkach MGC-803 hodowanych z H2 lub bez . b  Poziomy transkryptu lncRNA MALAT1, EZH2 analizowano metodą ilościowej PCR w czasie rzeczywistym. c  Poziomy białka EZH2 oceniano za pomocą immunoblotu. CK i Ctrl, Normalne warunki hodowli. *p < 0,01 w porównaniu do Ctrl

H2 hamował ekspresję EZH2 poprzez regulację w dół LncRNA MALAT1

Nadekspresja MALAT1 zwiększyła poziom mRNA (ryc.  3 a) i białka (ryc.  3 b) EZH2 w komórkach MGC-803 i BGC-823. Ponadto LncRNA MALAT1 zniósł hamowanie ekspresji EZH2 przez H2 ( ryc.  3 a, b).

Ryc. 3
rysunek 3

H2 hamował proliferację i migrację komórek raka żołądka poprzez regulację lncRNA MALAT1. a  Poziomy transkryptu lncMALAT1 i EZH2 komórek MGC-803 mierzono metodą ilościowej PCR w czasie rzeczywistym. b  Poziom białka EZH2 oceniano za pomocą immunoblotu. c  Komórki MGC-803 i BGC-823 transfekowane wektorem ekspresyjnym lncRNA MALAT1 lub bez niego hodowano z H2 lub bez niego przez 24 godziny i oceniano za pomocą testu MTT. d  Do zbadania wpływu H2 i lncRNA MALAT1 na migrację komórek MGC-803 i BGC-823 zastosowano test gojenia się ran poprzez zarysowanie . Pasek skali: 25 µm. Ctrl, Normalne warunki hodowli. *p < 0,01 w porównaniu do Ctrl; #p < 0,01 w porównaniu z MALAT1; & p < 0,01 w porównaniu z H2

LncRNA MALAT1 złagodził hamujący wpływ H2 na proliferację i migrację komórek raka żołądka

Jak wcześniej wykazano, że gazowy H2 hamuje proliferację i migrację komórek MGC-803 i BGC-823, następnie zbadaliśmy rolę LncRNA MALAT1 na wpływ H2 . Nadekspresja LncRNA MALAT1 spowodowała około 25% wzrost proliferacji komórek MGC-803 i BGC-823 (p < 0,01 MALAT1 vs. Ctrl) i zniosła hamowanie proliferacji narzucone przez H2 (p < 0,01 dla MALAT1 + H2 vs. MALAT1 i MALAT1 + H2 vs. H2 ) (Rys.  3c ). Nadekspresja LncRNA MALAT1 zwiększyła migrację komórek MGC-803 i BGC-823 o około 40% (p < 0,01 MALAT1 vs. Ctrl) (ryc.  3 D). Co więcej, MALAT1 znosił hamujący wpływ H2gazu na migrację komórek raka żołądka MGC-803 (p < 0,01 dla MALAT1 + H2 w porównaniu z MALAT1 i MALAT1 + H2 w porównaniu z H2 ) (ryc.  3 d).

Ekspresja miR-124-3p w komórkach raka żołądka była regulowana przez H2 i lncRNA MALAT1

Przy użyciu LncBase Predicted v.2 ( http://carolina.imis.athena-innovation.gr/diana_tools ) zidentyfikowano has-miR-124-3p jako regulator i cel lncRNA MALAT1. W MALAT1 zidentyfikowano cztery silne miejsca wiązania miR-124-3p (ryc.  4 a) i wiele innych niedoskonałych miejsc wiązania miR-124-3p. Poziom miR-124-3p komórek MGC-803 i BGC-823 wzrósł o ponad 100% po traktowaniu H2 ( p < 0,01, H2 vs. Ctrl) (ryc.  4 b). Z drugiej strony nadekspresja lncRNA MALAT1 obniżyła poziom miR-124-3p o ponad 40% (p < 0,01 MALAT1 vs. Ctrl). Ponadto lncRNA MALAT1 i gaz H 2 antagonizowały wzajemne działanie na ekspresję miR-124-3p (p < 0,01 dla MALAT1 + H 2vs. MALAT1 i MALAT1 + H2 vs. H2 ) (Rys.  4 b).

Ryc. 4
rysunek 4

LncRNA MALAT1 pośredniczył w wpływie H2 na ekspresję miR-124-3p w komórkach raka żołądka. a  Miejsca wiązania miR-124-3p w sekwencji transkryptu lncRNA MALAT1 przewidziano przy użyciu LncBase Predicted v.2 Diana Tools. b  Poziom ekspresji miR-124-3p w komórkach MGC-803 i BGC-823 transfekowanych wektorem ekspresyjnym lncRNA MALAT1 lub bez niego i hodowanych z H2 lub bez niego przez 24 godziny oznaczono metodą ilościowej PCR w czasie rzeczywistym. *p < 0,01 w porównaniu do kontroli; # p < 0,01 w porównaniu z MALAT1; & p < 0,01 w porównaniu z H2

LncRNA MALAT1 zwiększył ekspresję EZH2 poprzez hamowanie miR-124-3p

Ponieważ miR-124-3p był regulowany przez lncRNA MALAT1, a EZH2 zidentyfikowano jako bezpośredni cel miR-124-3p (ryc.  5 a), wpływ miR-124-3p na regulację ekspresji EZH2 przez lncRNA MALAT1 był oceniony. Transfekcja mimetyków miR-124-3p zmniejszyła poziom mRNA EZH2 o około 50% (p < 0,01, miR-124-3p vs. Ctrl) i zahamowała regulację w górę EZH2 przez lncRNA MALAT1 (p < 0,01 dla miR-124-3p + MALAT1 vs. MALAT1 i miR-124-3p + MALAT1 vs. miR-124-3p) (ryc.  5 b). Co więcej, lncRNA MALAT1 i miR-124-3p wzajemnie hamują wzajemną ekspresję (ryc.  5 )B). Poziom białka EZH2 został zmniejszony o około 60% przez miR-124-3p (p < 0,01, miR-124-3p vs. Ctrl), a miR-124-3p zniósł indukowaną przez lncRNA MALAT1 regulację w górę EZH2 (p < 0,01 dla miR- 124-3p + MALAT1 vs. MALAT1 i miR-124-3p + MALAT1 vs. miR-124-3p) (ryc.  5 c).

Ryc. 5
rysunek 5

Zwiększenie poziomu EZH2 przez lncRNA MALAT1 było antagonizowane przez miR-124-3p. a  Miejsce wiązania miR-124-3p w EZH2 3’UTR przewidywane przy użyciu TargetScan. b  Poziomy ekspresji lncRNA MALAT1, miR-124-3p i EZH2 po nadekspresji lncRNA MALAT1 i/lub miR-124-3p analizowano metodą ilościowej PCR w czasie rzeczywistym. c  Wpływ lncRNA MALAT1 i miR-124-3p na poziom białka EZH2 zbadano metodą Western blot. Ctrl, Normalne warunki hodowli. *p < 0,01 w porównaniu do kontroli; # p < 0,01 w porównaniu z MALAT1; & p < 0,01 w porównaniu do 124-3 p

miR-124-3p zniósł lncRNA indukowany przez MALAT1 proliferację i migrację komórek raka żołądka

Żywotne komórki MGC-803 i BGC-823 zostały zredukowane o ponad 20% przez mimetyki miR-124-3p (p < 0,01, miR-124-3p vs. Ctrl) i promowanie proliferacji komórek MGC-803 i BGC-823 przez lncRNA MALAT1 był hamowany przez miR-124-3p (p < 0,01 dla miR-124-3p + MALAT1 vs. MALAT1 i miR-124-3p + MALAT1 vs. miR-124-3p) (ryc. 6 a  ) . miR-124-3p hamował także tempo migracji komórek MGC-803 i BGC-823 o około 50% (p < 0,01, miR-124-3p vs. Ctrl) i znosił indukowany przez lncRNA MALAT1 wzrost ruchliwości komórek (p < 0,01 dla miR-124-3p + MALAT1 vs. MALAT1 i miR-124-3p + MALAT1 vs. miR-124-3p) (ryc.  6 b).

Ryc. 6
rysunek 6

miR-124-3p blokował lncRNA MALAT1 indukował proliferację i migrację komórek raka żołądka. a  Komórki MGC-803 transfekowane lncRNA MALAT1 i/lub miR-124-3p hodowano przez 24 godziny i oceniano za pomocą testu MTT. b  Migrację komórek MGC-803 i BGC-823 z nadekspresją lncRNA MALAT1 i/lub miR-124-3p badano za pomocą testu gojenia się ran poprzez zadrapanie. Pasek skali: 25 µm. Ctrl, Normalne warunki hodowli. *p < 0,01 w porównaniu do kontroli; # p < 0,01 w porównaniu z MALAT1; & p < 0,01 w porównaniu do 124-3 p

LncRNA MALAT1 i miR-124-3p pośredniczyły w hamowaniu wzrostu nowotworu przez H2

Wdychanie H 2 drastycznie hamowało wzrost nowotworu u myszy z heteroprzeszczepem komórek BGC-823 (p < 0,01, H 2 vs. Ctrl) (ryc.  7 ), co było zgodne z obserwacjami klinicznymi różnych nowotworów [ 23 , 25 ]. Nadekspresja lncRNA MALAT1 częściowo tłumiona H2 spowodowała zahamowanie wzrostu nowotworu, podczas gdy miR-124-3p przeciwdziałała działaniu lncR MALAT1 (ryc.  7 a). Poziom białka EZH2 w tkance nowotworu żołądka obniżył się o ponad 50% w wyniku ekspozycji na H2 , co zostało wzmocnione przez miR-124-3p i tłumione przez lncRNA MALAT1 (ryc.  7b ).

Ryc. 7
rysunek 7

H2 hamował wzrost guza żołądka poprzez oś lncRNA MALAT1/miR-124-3p. Komórki BGC-823 stabilnie eksprymujące lncRNA MALAT1 i/lub miR-124-3p wszczepiono podskórnie nagim myszom. Następnie myszy wystawiano na działanie H2 przez 2 godziny dziennie przez 5 tygodni. a  Pokazano obraz reprezentatywnych guzów (górny panel) i zmierzono wielkość guza (dolny panel). b  Poziom białka EZH2 w tkance nowotworowej oceniano metodą Western blot. *p < 0,01 w porównaniu do Ctrl; ^ p < 0,01 w porównaniu z H2 +  124-3p; # p < 0,01 w porównaniu z H2 +  MALAT1; & p < 0,01 w porównaniu z H2

Dyskusja

Gaz H2 hamował proliferację i migrację komórek raka żołądka MGC-803 i BGC-823 oraz obniżał ekspresję lncRNA MALAT1 i EZH2 Hamowanie EZH2 przez H2 zostało złagodzone przez nadekspresję lncRNA MALAT1. LncRNA MALAT1 łagodził również H2, powodując hamowanie proliferacji i migracji komórek raka żołądka MGC-803 i BGC-823. MikroRNA hsa-miR-124-3p zidentyfikowano jako cel i regulator lncRNA MALAT1 i tłumił ekspresję EZH2. H2 zwiększył ekspresję miR-124-3p, która została zniesiona przez nadekspresję lncRNA MALAT1 LncRNA MALAT1 promował proliferację i migrację komórek MGC-803 i BGC-823, które zostały zniesione przez mimetyki miR-124-3p. H 2ekspozycja drastycznie zmniejszyła wzrost raka żołądka w mysim modelu heteroprzeszczepu i zahamowała ekspresję EZH2 w tkance nowotworowej, która została wzmocniona przez miR-124-3p i tłumiona przez lncRNA MALAT1.

Podobne Treści :  Komórki macierzyste - stem cells

Wykazano, że gazowy H 2 poprawia wiele warunków poprzez usuwanie szkodliwych ROS [ 27 ]. Wdychanie wysokiego stężenia wodoru chroniło komórki zwojowe siatkówki szczura przed uszkodzeniem siatkówki związanym z niedokrwieniem/reperfuzją (I/R), powodując stres oksydacyjny, stan zapalny i apoptozę [28 ] . Wdychanie H 2 łagodziło okluzję tętnicy środkowej mózgu wywołane uszkodzeniem I/R mózgu, o czym świadczy zmniejszona produkcja 3-nitrotyrozyny i 8-hydroksy-2-deoksyguanozyny, złagodzenie stanu zapalnego i zmniejszona apoptoza nerwowa [ 29 ] . Wykazano, że sygnalizacja PI3K/AKT1 pośredniczy w ochronie H2 w przypadku urazów serca wywołanych I/R [ 30] U pacjentów ze złośliwym rakiem wątroby picie wody bogatej w wodór podczas radioterapii znacznie obniżyło poziom wodoronadtlenku we krwi i zwiększyło biologiczne działanie antyoksydacyjne, co doprowadziło do poprawy jakości życia [ 24 ]. Codzienna inhalacja H 2 zatrzymała wzrost guzów pierwotnych i przerzutowych u pacjenta z rakiem pęcherzyka żółciowego z przerzutami, a poziom biomarkerów nowotworowych powrócił do normy [ 25 ]. Traktowanie H2 hamowało ekspresję CD47 i indukowało apoptozę komórek raka płuc A549 [ 31 ] . Inne badanie wykazało, że SMC3 pośredniczy w hamowaniu progresji raka płuc przez H2 w badaniu in vitro i mysim modelu ksenoprzeszczepu [ 26 ]. Obecne badanie wykazało, że H2 może hamować postęp i migrację komórek raka żołądka. Uzasadnione są dalsze badania nad wpływem H2 na progresję raka żołądka w modelach zwierzęcych.

Długi niekodujący RNA MALAT1 zidentyfikowano jako czynnik związany z przerzutami niedrobnokomórkowego raka płuc [ 32 ] i regulujący ekspresję genów poprzez inny mechanizm [ 16 ]. LncRNA MALAT1 ulegał nadekspresji w rakach żołądka w porównaniu z sąsiadującą normalną tkanką i promował proliferację, migrację i oporność komórek raka żołądka na cisplatynę poprzez aktywację szlaku PI3K/AKT [ 19 , 33 ]. LncRNA MALAT1 regulował ekspresję miR-30e/ATG5 w celu modulowania autofagii i apoptozy komórek raka żołądka SGC7901 i nadawał oporność na cisplatynę [ 34 ]. Wykazano, że MALAT1 bezpośrednio wiąże się i stabilizuje mRNA Sox2, co prowadzi do wzrostu łodygi oraz chemio- i radiooporności komórek raka żołądka [20 ]. Obecne badanie wykazało, że lncRNA MALAT1 promuje proliferację i migrację raka żołądka poprzez modulowanie osi miR-124-3p/EZH2.

Poziom mikroRNA miR-124-3p był znacząco obniżony w tkankach raka żołądka, a jego poziom był odwrotnie zależny od stopnia histologicznego, stopnia zaawansowania TNM i przerzutów do węzłów chłonnych. Co więcej, niska ekspresja miR-124-3p była skorelowana z niższym współczynnikiem przeżycia całkowitego i przeżycia wolnego od choroby [ 35 ]. Stwierdzono, że ITGB3 [ 36 ] i ZEB1 [ 37 ] są celem miR-124-3p w promowaniu proliferacji i inwazji raka żołądka. Co więcej, Circular RNA circ-PVT1 zwiększał ekspresję ZEB1 poprzez pochłanianie miR-124-3p i zwiększał oporność na paklitaksel komórek nowotworu żołądka i raka żołądka [ 37 ]. LncRNA XIST i miR-124-3p kompetycyjnie regulowały ekspresję EZH2 i modulowały proliferację, migrację i inwazję komórek raka płaskonabłonkowego krtani [38 ]. miR-124-3p był antagonizowany przez lncRNA MALAT1 w hamowaniu ekspresji Slug i przerzutów raka wątrobowokomórkowego [ 39 ]. Badanie to wykazało, że gaz H2 hamował wzrost raka żołądka in vivo oraz proliferację i migrację komórek raka żołądka in vitro poprzez zmniejszenie poziomu lncRNA MALAT1, co z kolei zwiększyło ekspresję miR-124-3p i obniżyło ekspresję EZH2 (Fig. 8  ) .

Ryc. 8
Cyfra 8

Proponowany model hamowania wzrostu i inwazji raka żołądka przez H2 . Szczegóły znajdziesz w tekście. 12935 2020 1743 Figa HTML aktywacja; 12935 2020 1743 Figb HTML zahamowanie

Wnioski

Badanie to wykazało skuteczność wodoru molekularnego w hamowaniu wzrostu raka żołądka poprzez zmniejszenie proliferacji i migracji komórek raka żołądka, co nastąpiło poprzez obniżenie poziomu lncRNA MALAT1 i członka rodziny grupy Polycomb EZH2 oraz zwiększenie poziomu miR-124-3p. Co więcej, miR-124-3p hamował ekspresję EZH2 i wzajemnie tłumił ekspresję siebie nawzajem za pomocą lncRNA MALAT1. Dane te wskazują, że H2 powinien być dalej badany pod kątem leczenia raka żołądka, a oś lncRNA MALAT1/miR-124-3p/EZH2 byłaby nowym celem interwencji.

Podobne Treści :  Rola wodoru H2 w chorobie Alzheimera - badanie przeglądowe

Dostępność danych i materiałów

Wszystkie dane wygenerowane lub przeanalizowane podczas tego badania zostały zawarte w manuskrypcie.

Skróty

MTT:
Bromek 3-(4,5-dimetylotiazol-2-ilo)-2,5-difenylotetrazoliowy
lncRNA:
Długie niekodujące RNA
miRNA:
MikroRNA
MALAT1:
Transkrypt gruczolakoraka płuc związany z przerzutami 1
EZH2:
Wzmacniacz podjednostki kompleksu represyjnego Zeste 2 Polycomb 2
GAPDH:
Dehydrogenaza 3-fosforanu aldehydu glicerynowego

Bibliografia

  1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Globalne statystyki dotyczące nowotworów 2018: szacunki GLOBOCAN dotyczące częstości występowania i umieralności na całym świecie dla 36 nowotworów w 185 krajach. CA Rak J Clin. 2018;68(6):394–424.

    Artykuł Google Scholar

  2. Poorolajal J, Moradi L, Mohammadi Y, Cheraghi Z, Gohari-Ensaf F. Czynniki ryzyka raka żołądka: przegląd systematyczny i metaanaliza. Zdrowie Epidemiolu. 2020;42:e2020004.

    Artykuł Google Scholar

  3. Berx G, Staes K, van Hengel J, Molemans F, Bussemakers MJ, van Bokhoven A i in. Klonowanie i charakterystyka ludzkiego genu supresora inwazji E-kadheryny (CDH1). Genomika. 1995;26(2):281–9.

    Artykuł CAS Google Scholar

  4. Brooks-Wilson AR, Kaurah P, Suriano G, Leach S, Senz J, Grehan N i in. Mutacje germinalne E-kadheryny w dziedzicznym rozlanym raku żołądka: ocena 42 nowych rodzin i przegląd genetycznych kryteriów przesiewowych. J Med Geneta. 2004;41(7):508–17.

    Artykuł CAS Google Scholar

  5. Gaston D, Hansford S, Oliveira C, Nightingale M, Pinheiro H, Macgillivray C i in. Mutacje linii zarodkowej w MAP3K6 są powiązane z rodzinnym rakiem żołądka. PLoS Genet. 2014;10(10):e1004669.

    Artykuł Google Scholar

  6. Li J, Woods SL, Healey S, Beesley J, Chen X, Lee JS i in. Mutacje punktowe w eksonie 1B APC ujawniają gruczolakoraka żołądka i polipowatość proksymalną żołądka jako rodzinny wariant polipowatości gruczolakowatej. Jestem J Hum Genet. 2016;98(5):830–42.

    Artykuł CAS Google Scholar

  7. Vogelaar IP, Ligtenberg MJ, van der Post RS, de Voer RM, Kets CM, Jansen TJ i in. Nawracająca kandydoza i rak żołądka o wczesnym początku u pacjenta z genetycznie zdefiniowanym częściowym defektem MYD88. Rak Fam. 2016;15(2):289–96.

    Artykuł CAS Google Scholar

  8. Sahasrabudhe R, Lott P, Bohorquez M, Toal T, Estrada AP, Suarez JJ i in. Mutacje linii zarodkowej w PALB2, BRCA1 i RAD51C, które regulują naprawę rekombinacji DNA u pacjentów z rakiem żołądka. Gastroenterologia. 2017;152(5):983–6.e6.

    Artykuł CAS Google Scholar

  9. Slavin T, Neuhausen SL, Rybak C, Solomon I, Nehoray B, Blazer K i in. Genetyczna podatność na raka żołądka w międzynarodowej sieci badawczej społeczności zajmującej się genomiką kliniczną nowotworów. Geneta raka. 2017;216–217:111–9.

    Artykuł Google Scholar

  10. Weren RDA, van der Post RS, Vogelaar IP, van Krieken JH, Spruijt L, Lubinski J i in. Rola aberracji linii zarodkowych wpływających na CTNNA1, MAP3K6 i MYD88 w podatności na raka żołądka. J Med Geneta. 2018;55(10):669–74.

    Artykuł CAS Google Scholar

  11. Fewings E, Larionov A, Redman J, Goldgraben MA, Scarth J, Richardson S i in. Warianty chorobotwórcze linii zarodkowej w PALB2 i innych genach predysponujących do raka w rodzinach z dziedzicznym rozlanym rakiem żołądka bez mutacji CDH1: badanie sekwencjonowania całego egzomu. Lancet Gastroenterol Hepatol. 2018;3(7):489–98.

    Artykuł Google Scholar

  12. Tedaldi G, Pirini F, Tebaldi M, Zampiga V, Cangini I, Danesi R i in. Wielogenowe badanie panelowe zwiększa liczbę loci związanych z predyspozycją do raka żołądka. Raki. 2019;11(9):E1340.

    Artykuł Google Scholar

  13. Rinn JL, Chang HY. Regulacja genomu przez długie niekodujące RNA. Annu Rev Biochem. 2012;81:145–66.

    Artykuł CAS Google Scholar

  14. Nakamura S, Kanda M, Kodera Y. Włączenie biomarkerów molekularnych do praktyki klinicznej raka żołądka. Ekspert Rev Anticancer Ther. 2019;19(9):757–71.

    Artykuł CAS Google Scholar

  15. Connerty P, Lock RB, de Bock CE. Długie niekodujące RNA: główne regulatory stresu komórkowego w raku. Przedni Onkol. 2020;10:285.

    Artykuł Google Scholar

  16. Chen Q, Zhu C, Jin Y. Onkogenne i hamujące nowotwory funkcje długiego niekodującego RNA MALAT1: pojawiające się kontrowersje. Przedni Genet. 2020;11:93.

    Artykuł CAS Google Scholar

  17. Zhang Z, Li M, Zhang Z. lncRNA MALAT1 moduluje oporność na oksaliplatynę raka żołądka poprzez gąbkowanie miR-22-3p. Onco celuje w to. 2020;13:1343–54.

    Artykuł CAS Google Scholar

  18. Shao G, Zhao Z, Zhao W, Hu G, Zhang L, Li W i in. Długi niekodujący RNA MALAT1 aktywuje autofagię i promuje proliferację komórek poprzez obniżenie ekspresji mikroRNA-204 w raku żołądka. Oncol Lett. 2020;19(1):805–12.

    CAS PubMed Google Scholar

  19. Zhu K, Ren Q, Zhao Y. Nadekspresja lncRNA MALAT1 sprzyja proliferacji, migracji i inwazji raka żołądka poprzez aktywację szlaku PI3K/AKT. Oncol Lett. 2019;17(6):5335–42.

    CAS PubMed Centrala PubMedu Google Scholar

  20. Xiao Y, Pan J, Geng Q, Wang G. LncRNA MALAT1 zwiększa łodygę komórek raka żołądka poprzez zwiększenie stabilności mRNA SOX2. FEBS Otwórz biografię. 2019;9(7):1212–22.

    Artykuł CAS Google Scholar

  21. Dole M, Wilson FR, Fife WP. Hiperbaryczna terapia wodorowa: możliwa metoda leczenia raka. Nauka. 1975;190(4210):152–4.

    Artykuł CAS Google Scholar

  22. Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K i in. Wodór działa jako terapeutyczny przeciwutleniacz, selektywnie redukując cytotoksyczne rodniki tlenowe. Nat Med. 2007;13(6):688–94.

    Artykuł CAS Google Scholar

  23. Li S, Liao R, Sheng X, Luo X, Zhang X, Wen X i in. Wodór gazowy w leczeniu nowotworów. Przedni Onkol. 2019;9:696.

    Artykuł Google Scholar

  24. Kang KM, Kang YN, Choi IB, Gu Y, Kawamura T, Toyoda Y i in. Wpływ picia wody bogatej w wodór na jakość życia pacjentów leczonych radioterapią z powodu nowotworów wątroby. Med Gas Res. 2011;1(1):11.

    Artykuł Google Scholar

  25. Chen JB, Pan ZB, Du DM, Qian W, Ma YY, Mu F i in. Terapia wodorem indukowała kurczenie się przerzutowego raka pęcherzyka żółciowego: opis przypadku. Światowe przypadki J Clin. 2019;7(15):2065–74.

    Artykuł Google Scholar

  26. Wang D, Wang L, Zhang Y, Zhao Y, Chen G. Wodór hamuje postęp raka płuc poprzez celowanie w SMC3. Biomed Farmakolog. 2018;104:788–97.

    Artykuł CAS Google Scholar

  27. Ishibashi T. Skuteczność terapeutyczna wodoru cząsteczkowego: nowy wgląd mechanistyczny. Curr Pharm Des. 2019;25(9):946–55.

    Artykuł CAS Google Scholar

  28. Wang R, Wu J, Chen Z, Xia F, Sun Q, Liu L. Kondycjonowanie końcowe wdychanym wodorem sprzyja przetrwaniu komórek zwojowych siatkówki w szczurzym modelu uszkodzenia niedokrwiennego / reperfuzyjnego siatkówki. Rozdzielczość mózgu 2016;1632:82–90.

    Artykuł CAS Google Scholar

  29. Cui J, Chen X, Zhai X, Shi D, Zhang R, Zhi X i in. Wdychanie wodoru pochodzącego z elektrolizy wody łagodzi uszkodzenia niedokrwienno-reperfuzyjne mózgu u szczurów – możliwe nowe źródło wodoru do zastosowań klinicznych. Neuronauka. 2016;335:232–41.

    Artykuł CAS Google Scholar

  30. Chen O, Cao Z, Li H, Ye Z, Zhang R, Zhang N i in. Wodór o wysokim stężeniu chroni serce myszy przed uszkodzeniem niedokrwiennym/reperfuzyjnym poprzez aktywację szlaku PI3K/Akt1. Republika Naukowa 2017;7(1):14871.

    Artykuł Google Scholar

  31. Meng J, Liu L, Wang D, Yan Z, Chen G. Wodór hamuje postęp raka płuc poprzez obniżenie poziomu CD47. Biosci Rep. 2020;40(4):BSR20192761.

    Artykuł Google Scholar

  32. Ji P, Diederichs S, Wang W, Böing S, Metzger R, Schneider PM i in. MALAT-1, nowy niekodujący RNA, i tymozyna beta4 pozwalają przewidzieć przerzuty i przeżycie niedrobnokomórkowego raka płuc we wczesnym stadium. Onkogen. 2003;22(39):8031–41.

    Artykuł Google Scholar

  33. Dai Q, Zhang T, Li C. LncRNA MALAT1 reguluje proliferację komórek i oporność na cisplatynę w raku żołądka poprzez szlak PI3K/AKT. Rak Manag Res. 2020;12:1929–39.

    Artykuł CAS Google Scholar

  34. Zhang YF, Li CS, Zhou Y, Lu XH. Propofol zwiększa wrażliwość na cisplatynę poprzez oś lncRNA MALAT1/miR-30e/ATG5 poprzez tłumienie autofagii w raku żołądka. Nauka życia. 2020;244:117280.

    Artykuł CAS Google Scholar

  35. Liu F, Hu H, Zhao J, Zhang Z, Ai X, Tang L i in. miR-124-3p działa jako potencjalny marker i hamuje wzrost guza w raku żołądka. Biomed Rep. 2018;9(2):147–55.

    CAS PubMed Centrala PubMedu Google Scholar

  36. Wu Q, Zhong H, Jiao L, Wen Y, Zhou Y, Zhou J i in. MiR-124-3p hamuje migrację i inwazję raka żołądka, celując w ITGB3. Pathol Res Pract. 2020;216(1):152762.

    Artykuł CAS Google Scholar

  37. Liu YY, Zhang LY, Du WZ. Okrągły RNA circ-PVT1 przyczynia się do oporności komórek raka żołądka na paklitaksel poprzez regulację ekspresji ZEB1 poprzez gąbkowanie miR-124-3p. Biosci Rep. 2019;39(12):BSR20193045.

    Artykuł CAS Google Scholar

  38. Xiao D, Cui X, Wang X. Długi niekodujący RNA XIST zwiększa agresywność raka płaskonabłonkowego krtani poprzez regulację miR-124-3p/EZH2. Rozdzielczość komórki Exp. 2019;381(2):172–8.

    Artykuł CAS Google Scholar

  39. Cui RJ, Fan JL, Lin YC, Pan YJ, Liu C, Wan JH i in. Dostępność miR-124-3p jest antagonizowana przez LncRNA-MALAT1 w przypadku przerzutów nowotworowych indukowanych przez ślimaka w raku wątrobowokomórkowym. Lek na raka 2019;8(14):6358–69.

    Artykuł CAS Google Scholar

Pobierz referencje

Podziękowanie

Nie dotyczy.

Finansowanie

Nie dotyczy.

Informacje o autorze

Autorzy i stowarzyszenia

Składki

WX wymyślił, zaprojektował badanie i napisał manuskrypt. BZ i HC przeprowadziły badanie i analizę danych. Wszyscy autorzy przeczytali i zatwierdzili ostateczną wersję manuskryptu.

Autor korespondencji

Korespondencja z Weiqiang Xu .

Deklaracje etyczne

Zatwierdzenie etyki i zgoda na udział

Nie dotyczy.

Zgoda na publikację

Nie dotyczy.

Konkurencyjne interesy

Autorzy nie deklarują potencjalnego konfliktu interesów.

Dodatkowe informacje

Notatka wydawcy

Springer Nature pozostaje neutralny w odniesieniu do roszczeń jurysdykcyjnych dotyczących opublikowanych map i powiązań instytucjonalnych.

Prawa i uprawnienia

Otwarty dostęp Ten artykuł jest objęty licencją Creative Commons Uznanie autorstwa 4.0, która pozwala na używanie, udostępnianie, adaptację, dystrybucję i reprodukcję na dowolnym nośniku lub w dowolnym formacie, pod warunkiem odpowiedniego podania oryginalnego autora (autorów) i źródła, podaj link do licencji Creative Commons i wskaż, czy wprowadzono zmiany. Obrazy lub inne materiały stron trzecich zawarte w tym artykule są objęte licencją Creative Commons artykułu, chyba że w linii kredytowej dotyczącej materiału wskazano inaczej. Jeśli materiał nie jest objęty licencją Creative Commons artykułu, a zamierzone użycie jest niezgodne z przepisami ustawowymi lub przekracza dozwolone użycie, konieczne będzie uzyskanie zgody bezpośrednio od właściciela praw autorskich. Aby wyświetlić kopię tej licencji, odwiedź stronęhttp://creativecommons.org/licenses/by/4.0/ . Zrzeczenie się prawa do udostępniania domeny publicznej Creative Commons ( http://creativecommons.org/publicdomain/zero/1.0/ ) ma zastosowanie do danych udostępnionych w tym artykule, chyba że w linii kredytowej dla danych określono inaczej.